ID: 1142304585_1142304599

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1142304585 1142304599
Species Human (GRCh38) Human (GRCh38)
Location 16:89278337-89278359 16:89278390-89278412
Sequence CCCCGCGGCCCAGGGCAGAGAGT GCTCAGAGCAGGGCCCCATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 175} {0: 1, 1: 0, 2: 0, 3: 22, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!