ID: 1142304680_1142304694

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1142304680 1142304694
Species Human (GRCh38) Human (GRCh38)
Location 16:89278675-89278697 16:89278726-89278748
Sequence CCAAGGGAGAAGGGGGCGGGGCA GTGAGGCCGTCCTGGTGGACGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 38, 4: 444} {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!