ID: 1142308096_1142308101

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1142308096 1142308101
Species Human (GRCh38) Human (GRCh38)
Location 16:89296864-89296886 16:89296880-89296902
Sequence CCCCACCAGAGGGCAGGAATGGG GAATGGGTCAGAAGTCTCATTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 256} {0: 1, 1: 0, 2: 0, 3: 16, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!