ID: 1142314347_1142314350

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1142314347 1142314350
Species Human (GRCh38) Human (GRCh38)
Location 16:89334250-89334272 16:89334263-89334285
Sequence CCCTCATCAATGGCCTTCACAAT CCTTCACAATCCCTGCTGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 244} {0: 1, 1: 0, 2: 1, 3: 14, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!