ID: 1142321317_1142321322

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1142321317 1142321322
Species Human (GRCh38) Human (GRCh38)
Location 16:89384799-89384821 16:89384833-89384855
Sequence CCCAACAACAGAACCGCTGCAGG GTGTGTAAGAACATGTGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 97} {0: 1, 1: 0, 2: 8, 3: 64, 4: 514}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!