ID: 1142324772_1142324775

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1142324772 1142324775
Species Human (GRCh38) Human (GRCh38)
Location 16:89407483-89407505 16:89407517-89407539
Sequence CCTCGTCAGGGCTGTTGCACGAC CCTAAGAAACAAACTCCTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!