ID: 1142328497_1142328502

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1142328497 1142328502
Species Human (GRCh38) Human (GRCh38)
Location 16:89434207-89434229 16:89434221-89434243
Sequence CCTCCTCAAGACACTATGGATTC TATGGATTCTGTGTGTCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 68} {0: 1, 1: 0, 2: 0, 3: 23, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!