ID: 1142340581_1142340583

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1142340581 1142340583
Species Human (GRCh38) Human (GRCh38)
Location 16:89519675-89519697 16:89519693-89519715
Sequence CCCGGCAGCAGTTGCTAACATTT CATTTTCACACAGCTTCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 192} {0: 1, 1: 0, 2: 1, 3: 18, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!