ID: 1142342432_1142342442

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1142342432 1142342442
Species Human (GRCh38) Human (GRCh38)
Location 16:89532292-89532314 16:89532335-89532357
Sequence CCTGAGGGGTGGCCAGGGGCCCC CTGTTTGTAGGGAATGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 52, 4: 350} {0: 1, 1: 0, 2: 2, 3: 23, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!