ID: 1142343900_1142343907

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1142343900 1142343907
Species Human (GRCh38) Human (GRCh38)
Location 16:89541894-89541916 16:89541921-89541943
Sequence CCCGGTAGGGAGCACGTGCCCTG GTGGCCACCCTGATACATAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 160} {0: 1, 1: 0, 2: 0, 3: 9, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!