ID: 1142354807_1142354817

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1142354807 1142354817
Species Human (GRCh38) Human (GRCh38)
Location 16:89597334-89597356 16:89597358-89597380
Sequence CCAGGCCCAGCACACCAGGATCC CCCTGGACTGAATGGGATGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 327} {0: 1, 1: 0, 2: 1, 3: 27, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!