ID: 1142354807_1142354823

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1142354807 1142354823
Species Human (GRCh38) Human (GRCh38)
Location 16:89597334-89597356 16:89597387-89597409
Sequence CCAGGCCCAGCACACCAGGATCC AGGCTGCCAGGGGCAGAGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 327} {0: 1, 1: 1, 2: 7, 3: 116, 4: 902}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!