ID: 1142363048_1142363056

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1142363048 1142363056
Species Human (GRCh38) Human (GRCh38)
Location 16:89636257-89636279 16:89636295-89636317
Sequence CCCACAGTTCTGGTCCGTGTACA AGAACAAAGACGCCGTGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 57} {0: 1, 1: 0, 2: 0, 3: 5, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!