ID: 1142396855_1142396863

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1142396855 1142396863
Species Human (GRCh38) Human (GRCh38)
Location 16:89837017-89837039 16:89837063-89837085
Sequence CCCAGATTCCTGTTCTGTAGGTC TTTCCAAAGCTGCCCGTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 153} {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!