ID: 1142413124_1142413137

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1142413124 1142413137
Species Human (GRCh38) Human (GRCh38)
Location 16:89926169-89926191 16:89926207-89926229
Sequence CCCTCCCCGGGGCGGGGTTCGCC GGGAGCCTTTGTCCTCCGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102} {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!