ID: 1142421215_1142421218

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1142421215 1142421218
Species Human (GRCh38) Human (GRCh38)
Location 16:89971814-89971836 16:89971833-89971855
Sequence CCGCTTCAAATCGTCGTAACACT CACTTCCAATTTGAGGTCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35} {0: 1, 1: 0, 2: 0, 3: 11, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!