ID: 1142425777_1142425788

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1142425777 1142425788
Species Human (GRCh38) Human (GRCh38)
Location 16:90001555-90001577 16:90001599-90001621
Sequence CCTGTTCGTGAACACTTTTCCTG TTATTAGGAAGGCCCCTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104} {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!