ID: 1142428591_1142428601

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1142428591 1142428601
Species Human (GRCh38) Human (GRCh38)
Location 16:90013793-90013815 16:90013831-90013853
Sequence CCCTTCTGAGGGACGGCCAGTGC GGCTGTGCTCCCATTTTAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 74} {0: 1, 1: 0, 2: 0, 3: 14, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!