ID: 1142431845_1142431857

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1142431845 1142431857
Species Human (GRCh38) Human (GRCh38)
Location 16:90032893-90032915 16:90032936-90032958
Sequence CCAGTGAGGTGGTGGTGAAGAAC GGGGGCACCTGGAGGCTGACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 159} {0: 1, 1: 0, 2: 5, 3: 40, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!