ID: 1142443245_1142443250

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1142443245 1142443250
Species Human (GRCh38) Human (GRCh38)
Location 16:90115753-90115775 16:90115803-90115825
Sequence CCACACCTGGCCTGCTATCTATA GATATTTACCCAGTTTTATTTGG
Strand - +
Off-target summary No data {0: 4, 1: 2, 2: 2, 3: 30, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!