ID: 1142464143_1142464147

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1142464143 1142464147
Species Human (GRCh38) Human (GRCh38)
Location 17:119040-119062 17:119081-119103
Sequence CCCACATAAAACTGGGTAAATAT AAATAAAATATATAGATAGCAGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 2, 3: 26, 4: 310} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!