ID: 1142465333_1142465346

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1142465333 1142465346
Species Human (GRCh38) Human (GRCh38)
Location 17:133955-133977 17:134007-134029
Sequence CCTGGGGGGCGGGGGGAGGCGCG CTGTGGGTTTGGGGGGAGGTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 13, 3: 109, 4: 886} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!