ID: 1142470708_1142470715

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1142470708 1142470715
Species Human (GRCh38) Human (GRCh38)
Location 17:161828-161850 17:161848-161870
Sequence CCACCTCCAGCACCCTGAGAGGC GGCCCCAGGAAGCACCTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 7, 3: 74, 4: 547} {0: 1, 1: 0, 2: 4, 3: 31, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!