ID: 1142486178_1142486189

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1142486178 1142486189
Species Human (GRCh38) Human (GRCh38)
Location 17:248894-248916 17:248926-248948
Sequence CCTCCTTCCTGTCCCTTCCGCTC GGGCGAAGCAACCGAGGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 112, 4: 1080} {0: 1, 1: 0, 2: 0, 3: 5, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!