ID: 1142496541_1142496547

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1142496541 1142496547
Species Human (GRCh38) Human (GRCh38)
Location 17:309396-309418 17:309410-309432
Sequence CCCGCCCTGCCCAGGGCTCCTGC GGCTCCTGCCAGCCCCCTGCTGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 21, 3: 179, 4: 1143} {0: 2, 1: 2, 2: 7, 3: 73, 4: 456}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!