ID: 1142496555_1142496566

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1142496555 1142496566
Species Human (GRCh38) Human (GRCh38)
Location 17:309422-309444 17:309465-309487
Sequence CCCCCTGCTGGGGGTCCGGGATA GCTCCTGCCAGCCCCCCTGCTGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 0, 3: 9, 4: 102} {0: 2, 1: 1, 2: 3, 3: 47, 4: 463}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!