ID: 1142496600_1142496617

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1142496600 1142496617
Species Human (GRCh38) Human (GRCh38)
Location 17:309537-309559 17:309586-309608
Sequence CCCCCTGCTGGGGGTCCGGGATA CTCCTGCCAGCCTCCTGCTGGGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 0, 3: 9, 4: 102} {0: 2, 1: 2, 2: 6, 3: 57, 4: 620}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!