ID: 1142506704_1142506705

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1142506704 1142506705
Species Human (GRCh38) Human (GRCh38)
Location 17:368764-368786 17:368778-368800
Sequence CCTTTGTGCTATTATTGTTATAC TTGTTATACAAATTATATCTTGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 68, 3: 150, 4: 541} {0: 1, 1: 0, 2: 3, 3: 44, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!