ID: 1142506954_1142506960

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1142506954 1142506960
Species Human (GRCh38) Human (GRCh38)
Location 17:370550-370572 17:370601-370623
Sequence CCAAATGGGATCAGAGACACATG AAGTCAGCCAAGTCCTCCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148} {0: 1, 1: 0, 2: 0, 3: 19, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!