|
Left Crispr |
Right Crispr |
| Crispr ID |
1142508432 |
1142508453 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:380494-380516
|
17:380545-380567
|
| Sequence |
CCTCCCGGAAGCCCCCCTCATGC |
GAAGCCCTCCTCATCCCTCCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 9, 2: 14, 3: 29, 4: 191} |
{0: 14, 1: 14, 2: 15, 3: 46, 4: 381} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|