|
Left Crispr |
Right Crispr |
| Crispr ID |
1142508447 |
1142508461 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:380530-380552
|
17:380567-380589
|
| Sequence |
CCCTCATCCCTCCCGGAAGCCCT |
GAAGCCCCCCTCATGCTTCCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 5, 2: 4, 3: 38, 4: 281} |
{0: 3, 1: 8, 2: 5, 3: 37, 4: 154} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|