|
Left Crispr |
Right Crispr |
Crispr ID |
1142508448 |
1142508453 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:380531-380553
|
17:380545-380567
|
Sequence |
CCTCATCCCTCCCGGAAGCCCTC |
GAAGCCCTCCTCATCCCTCCCGG |
Strand |
- |
+ |
Off-target summary |
{0: 19, 1: 17, 2: 11, 3: 49, 4: 371} |
{0: 14, 1: 14, 2: 15, 3: 46, 4: 381} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|