ID: 1142508456_1142508461

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1142508456 1142508461
Species Human (GRCh38) Human (GRCh38)
Location 17:380553-380575 17:380567-380589
Sequence CCTCATCCCTCCCGGAAGCCCCC GAAGCCCCCCTCATGCTTCCCGG
Strand - +
Off-target summary {0: 8, 1: 21, 2: 17, 3: 39, 4: 539} {0: 3, 1: 8, 2: 5, 3: 37, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!