|
Left Crispr |
Right Crispr |
| Crispr ID |
1142508574 |
1142508591 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:380877-380899
|
17:380917-380939
|
| Sequence |
CCCCCCACATCCCTCCCGGAAGC |
GAAGCCCTCCTCATGCCTCCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 10, 2: 62, 3: 5132, 4: 3008} |
{0: 2, 1: 24, 2: 17, 3: 35, 4: 318} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|