|
Left Crispr |
Right Crispr |
Crispr ID |
1142508692 |
1142508710 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:381208-381230
|
17:381251-381273
|
Sequence |
CCCCCCCCCACATCCCTCCCGGA |
GAACCCCTCCTCATCCCTCCCGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 318, 2: 170, 3: 119, 4: 843} |
{0: 1, 1: 14, 2: 15, 3: 54, 4: 1247} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|