ID: 1142508695_1142508704

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1142508695 1142508704
Species Human (GRCh38) Human (GRCh38)
Location 17:381211-381233 17:381229-381251
Sequence CCCCCCACATCCCTCCCGGAAGC GAAGCCCTCCTCATGCTTCCCGG
Strand - +
Off-target summary {0: 5, 1: 10, 2: 62, 3: 5132, 4: 3008} {0: 7, 1: 5, 2: 18, 3: 35, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!