|
Left Crispr |
Right Crispr |
| Crispr ID |
1142508700 |
1142508710 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:381221-381243
|
17:381251-381273
|
| Sequence |
CCCTCCCGGAAGCCCTCCTCATG |
GAACCCCTCCTCATCCCTCCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 15, 2: 9, 3: 17, 4: 182} |
{0: 1, 1: 14, 2: 15, 3: 54, 4: 1247} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|