ID: 1142509620_1142509639

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1142509620 1142509639
Species Human (GRCh38) Human (GRCh38)
Location 17:385707-385729 17:385749-385771
Sequence CCAGGTGCAGAGGGGCGGCAGCC CCGCACGTGCGCGCCGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 240} {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!