ID: 1142509666_1142509693

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1142509666 1142509693
Species Human (GRCh38) Human (GRCh38)
Location 17:385848-385870 17:385893-385915
Sequence CCCGCCCCCCCCCACCCGCACCC CCCCGAGGGTCCCCGAGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 55, 3: 745, 4: 5026} {0: 1, 1: 0, 2: 1, 3: 10, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!