ID: 1142509770_1142509781

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1142509770 1142509781
Species Human (GRCh38) Human (GRCh38)
Location 17:386097-386119 17:386128-386150
Sequence CCCTGTGCGCCCCGCCGGCCCCG CCGCGCGCACCCCCCGCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 279} {0: 1, 1: 0, 2: 5, 3: 23, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!