ID: 1142526840_1142526850

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1142526840 1142526850
Species Human (GRCh38) Human (GRCh38)
Location 17:548715-548737 17:548762-548784
Sequence CCAATCTTAACTCTGTCAGTCCA CCTGGGATGTTGAATGAGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 150} {0: 1, 1: 0, 2: 1, 3: 23, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!