ID: 1142528864_1142528870

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1142528864 1142528870
Species Human (GRCh38) Human (GRCh38)
Location 17:565204-565226 17:565240-565262
Sequence CCAGCCTGACCAACATAGAGAAA AAAAACACAAAAAATTAGCCAGG
Strand - +
Off-target summary {0: 681, 1: 20780, 2: 48287, 3: 153114, 4: 205719} {0: 1984, 1: 54984, 2: 65457, 3: 54187, 4: 93581}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!