|
Left Crispr |
Right Crispr |
| Crispr ID |
1142528864 |
1142528873 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:565204-565226
|
17:565251-565273
|
| Sequence |
CCAGCCTGACCAACATAGAGAAA |
AAATTAGCCAGGCGTGGTGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 681, 1: 20780, 2: 48287, 3: 153114, 4: 205719} |
{0: 11026, 1: 40196, 2: 61434, 3: 51156, 4: 27800} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|