ID: 1142528865_1142528872

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1142528865 1142528872
Species Human (GRCh38) Human (GRCh38)
Location 17:565208-565230 17:565248-565270
Sequence CCTGACCAACATAGAGAAACCCC AAAAAATTAGCCAGGCGTGGTGG
Strand - +
Off-target summary {0: 457, 1: 14037, 2: 38745, 3: 124583, 4: 205796} {0: 14455, 1: 74040, 2: 160786, 3: 193764, 4: 190433}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!