|
Left Crispr |
Right Crispr |
Crispr ID |
1142528866 |
1142528872 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:565213-565235
|
17:565248-565270
|
Sequence |
CCAACATAGAGAAACCCCGTCTT |
AAAAAATTAGCCAGGCGTGGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 5, 1: 556, 2: 13214, 3: 76431, 4: 159952} |
{0: 14455, 1: 74040, 2: 160786, 3: 193764, 4: 190433} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|