|
Left Crispr |
Right Crispr |
| Crispr ID |
1142528867 |
1142528870 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:565227-565249
|
17:565240-565262
|
| Sequence |
CCCCGTCTTCACTAAAAACACAA |
AAAAACACAAAAAATTAGCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 293, 2: 9403, 3: 123953, 4: 231382} |
{0: 1984, 1: 54984, 2: 65457, 3: 54187, 4: 93581} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|