|
Left Crispr |
Right Crispr |
| Crispr ID |
1142528868 |
1142528876 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:565228-565250
|
17:565275-565297
|
| Sequence |
CCCGTCTTCACTAAAAACACAAA |
TGCCTGTAATCCCAGCTACTCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 540, 2: 16512, 3: 191682, 4: 213241} |
{0: 52453, 1: 101789, 2: 153905, 3: 227834, 4: 315316} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|