|
Left Crispr |
Right Crispr |
Crispr ID |
1142528869 |
1142528871 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:565229-565251
|
17:565245-565267
|
Sequence |
CCGTCTTCACTAAAAACACAAAA |
CACAAAAAATTAGCCAGGCGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 8, 1: 633, 2: 18905, 3: 215866, 4: 134925} |
{0: 402, 1: 11364, 2: 41958, 3: 65868, 4: 104463} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|