ID: 1142528869_1142528879

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1142528869 1142528879
Species Human (GRCh38) Human (GRCh38)
Location 17:565229-565251 17:565279-565301
Sequence CCGTCTTCACTAAAAACACAAAA TGTAATCCCAGCTACTCGGGAGG
Strand - +
Off-target summary {0: 8, 1: 633, 2: 18905, 3: 215866, 4: 134925} {0: 44593, 1: 206846, 2: 252437, 3: 185282, 4: 427506}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!