ID: 1142541165_1142541169

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1142541165 1142541169
Species Human (GRCh38) Human (GRCh38)
Location 17:660632-660654 17:660646-660668
Sequence CCTTGGGGAAGGACGAGGGCCCC GAGGGCCCCTGGGTGCTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 219} {0: 2, 1: 0, 2: 4, 3: 33, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!